Nanotechnological advances in cancer: therapy a comprehensive review of carbon nanotube applications.

Nanotechnology is revolutionising different areas from manufacturing to therapeutics in the health field. Carbon nanotubes (CNTs), a promising drug candidate in nanomedicine, have attracted attention due to their excellent and unique mechanical, electronic, and physicochemical properties. This emerging nanomaterial has attracted a wide range of scientific interest in the last decade. Carbon nanotubes have many potential applications in cancer therapy, such as imaging, drug delivery, and combination therapy. Carbon nanotubes can be used as carriers for drug delivery systems by carrying anticancer drugs and enabling targeted release to improve therapeutic efficacy and reduce adverse effects on healthy tissues. In addition, carbon nanotubes can be combined with other therapeutic approaches, such as photothermal and photodynamic therapies, to work synergistically to destroy cancer cells. Carbon nanotubes have great potential as promising nanomaterials in the field of nanomedicine, offering new opportunities and properties for future cancer treatments. In this paper, the main focus is on the application of carbon nanotubes in cancer diagnostics, targeted therapies, and toxicity evaluation of carbon nanotubes at the biological level to ensure the safety and real-life and clinical applications of carbon nanotubes.

Composite System of Lauryl Glucoside and Lauryl Glycoside Sulfosuccinate: Properties and Applications in Vitamin E Nanoemulsions.

The synergistic effect of surfactant compounding on performance can be leveraged to enhance product application performance. An investigation of the surface tension and emulsification properties revealed the complex synergistic effect of the composite system comprising lauryl glucoside (LG) and lauryl glycoside sulfosuccinate (LG-SS). The composite system was used as an emulsifier for vitamin E (VE) emulsification. VE nanoemulsions with high VE content were successfully prepared. The nanoemulsion appears homogeneous and transparent and has an average size of approximately 200 nm. It has better temperature and centrifugal stability, an antioxidant capacity 2.89 times that of untreated VE, and is not easily oxidized and deactivated. In this study, we successfully constructed a complex system of LG and its derivatives and applied it to VE emulsification - this is a step toward expanding the effective application of glycosides and their derivative composite systems in food, pharmaceutics, and other industries.

CD276-dependent efferocytosis by tumor-associated macrophages promotes immune evasion in bladder cancer.

Interplay between innate and adaptive immune cells is important for the antitumor immune response. However, the tumor microenvironment may turn immune suppressive, and tumor associated macrophages are playing a role in this transition. Here, we show that CD276, expressed on tumor-associated macrophages (TAM), play a role in diminishing the immune response against tumors. Using a model of tumors induced by N-butyl-N-(4-hydroxybutyl) nitrosamine in BLCA male mice we show that genetic ablation of CD276 in TAMs blocks efferocytosis and enhances the expression of the major histocompatibility complex class II (MHCII) of TAMs. This in turn increases CD4 + and cytotoxic CD8 + T cell infiltration of the tumor. Combined single cell RNA sequencing and functional experiments reveal that CD276 activates the lysosomal signaling pathway and the transcription factor JUN to regulate the expression of AXL and MerTK, resulting in enhanced efferocytosis in TAMs. Proving the principle, we show that simultaneous blockade of CD276 and PD-1 restrain tumor growth better than any of the components as a single intervention. Taken together, our study supports a role for CD276 in efferocytosis by TAMs, which is potentially targetable for combination immune therapy.

The use of amino acids and their derivates to mitigate against pesticide-induced toxicity.

Exposure to pesticides induces oxidative stress and deleterious effects on various tissues in non-target organisms. Numerous models investigating pesticide exposure have demonstrated metabolic disturbances such as imbalances in amino acid levels within the organism. One potentially effective strategy to mitigate pesticide toxicity involves dietary intervention by supplementing exogenous amino acids and their derivates to augment the body's antioxidant capacity and mitigate pesticide-induced oxidative harm, whose mechanism including bolstering glutathione synthesis, regulating arginine-NO metabolism, mitochondria-related oxidative stress, and the open of ion channels, as well as enhancing intestinal microecology. Enhancing glutathione synthesis through supplementation of substrates N-acetylcysteine and glycine is regarded as a potent mechanism to achieve this. Selection of appropriate amino acids or their derivates for supplementation, and determining an appropriate dosage, are of the utmost importance for effective mitigation of pesticide-induced oxidative harm. More experimentation is required that involves large population samples to validate the efficacy of dietary intervention strategies, as well as to determine the effects of amino acids and their derivates on long-term and low-dose pesticide exposure. This review provides insights to guide future research aimed at preventing and alleviating pesticide toxicity through dietary intervention of amino acids and their derivates.

Biofluid biomarkers for Alzheimer's disease.

Alzheimer's disease (AD) is a multifactorial neurodegenerative disease, with a complex pathogenesis and an irreversible course. Therefore, the early diagnosis of AD is particularly important for the intervention, prevention, and treatment of the disease. Based on the different pathophysiological mechanisms of AD, the research progress of biofluid biomarkers are classified and reviewed. In the end, the challenges and perspectives of future research are proposed.

Consistency analysis of PD-L1 expression in NSCLC between pleural effusion and matched primary lung cancer tissues by immunohistochemical double staining.

In clinical practice, PD-L1 detection is prone to nonspecific staining due to the complex cellular composition of pleural effusion smears. In this study, DAB and AEC immunohistochemistry (IHC) double staining was performed to investigate PD-L1 expression in tumor cells from malignant pleural effusion (MPE). MPE was considered as a metastasis in non-small cell lung cancer (NSCLC) patients, thus, the heterogeneity between metastatic and primary lung cancer was revealed as well. Ninety paired specimens of MPE cell blocks (CBs) and matched primary lung cancer tissues from NSCLC patients were subjected to PD-L1 and TTF-1/p63 IHC double staining. Two experienced pathologists independently evaluated PD-L1 expression using three cutoffs (1%, 10%, 50%). PD-L1 expression in MPE was strongly correlated with that in matched primary lung cancer tissues (R=0.813, P<0.001). Using a 4-tier scale (cutoffs 1%, 10%, 50%), the concordance was 71.1% (Cohen's κ=0.534). Using a 2-tier scale, the concordance was 75.6% (1%, Cohen's κ=0.53), 78.9% (10%, Cohen's κ=0.574) and 95.6% (50%, Cohen's κ=0.754). The rates of PD-L1 positivity in MPE(56.7%) were higher than in lung tissues(32.2%). All 27 discordant cases had higher scores in MPE. The double-staining method provided superior identification of PD-L1-positive tumor cells on a background with nonspecific staining. In conclusion, PD-L1 expression was moderately concordant between metastatic MPE CBs and matched primary lung carcinoma tissues, with variability related to tumor heterogeneity. MPE should be considered to detect PD-L1 when histological specimens are unattainable, especially when PD-L1 expression is > 50%. PD-L1 positivity rates were higher in MPE. Double staining can improve PD-L1 detection by reducing false negative/positive results.

The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Decoding emotional responses to AI-generated architectural imagery.

Introduction: The integration of AI in architectural design represents a significant shift toward creating emotionally resonant spaces. This research investigates AI's ability to evoke specific emotional responses through architectural imagery and examines the impact of professional training on emotional interpretation. Methods: We utilized Midjourney AI software to generate images based on direct and metaphorical prompts across two architectural settings: home interiors and museum exteriors. A survey was designed to capture participants' emotional responses to these images, employing a scale that rated their immediate emotional reaction. The study involved 789 university students, categorized into architecture majors (Group A) and non-architecture majors (Group B), to explore differences in emotional perception attributable to educational background. Results: Findings revealed that AI is particularly effective in depicting joy, especially in interior settings. However, it struggles to accurately convey negative emotions, indicating a gap in AI's emotional range. Architecture students exhibited a greater sensitivity to emotional nuances in the images compared to non-architecture students, suggesting that architectural training enhances emotional discernment. Notably, the study observed minimal differences in the perception of emotions between direct and metaphorical prompts among architecture students, indicating a consistent emotional interpretation across prompt types. Conclusion: AI holds significant promise in creating spaces that resonate on an emotional level, particularly in conveying positive emotions like joy. The study contributes to the understanding of AI's role in architectural design, emphasizing the importance of emotional intelligence in creating spaces that reflect human experiences. Future research should focus on expanding AI's emotional range and further exploring the impact of architectural training on emotional perception.

Therapeutic and immune-regulation effects of Scutellaria baicalensis Georgi polysaccharide on pseudorabies in piglets.

Pseudorabies virus (PRV) can cause fatal encephalitis in newborn pigs and escape the immune system. While there is currently no effective treatment for PRV, Scutellaria baicalensis Georgi polysaccharides (SGP) and Rodgersia sambucifolia Hemsl flavonoids (RHF) are traditional Chinese herbal medicines with potential preventive and therapeutic effects against PRV infection. In order to explore which one is more effective in the prevention and treatment of PRV infection in piglets. We investigate the therapeutic effects of RHF and SGP in PRV-infected piglets using clinical symptom and pathological injury scoring systems. The immune regulatory effects of RHF and SGP on T lymphocyte transformation rate, cytokines, T cells, and Toll-like receptors were also measured to examine the molecular mechanisms of these effects. The results showed that SGP significantly reduced clinical symptoms and pathological damage in the lungs, liver, spleen, and kidneys in PRV-infected piglets and the T lymphocyte conversion rate in the SGP group was significantly higher than that in the other treatment groups, this potential dose-dependent effect of SGP on T lymphocyte conversation. Serum immunoglobulin and cytokine levels in the SGP group fluctuated during the treatment period, with SGP treatment showing better therapeutic and immunomodulatory effects in PRV-infected piglets than RHF or the combined SGP + RHF treatment. In conclusion, RHF and SGP treatments alleviate the clinical symptoms of PRV infection in piglets, and the immunomodulatory effect of SGP treatment was better than that of the RHF and a combination of both treatments. This study provides evidence for SGP in controlling PRV infection in piglets.

Genetic overlap between schizophrenia and cognitive performance.

Schizophrenia (SCZ), a highly heritable mental disorder, is characterized by cognitive impairment, yet the extent of the shared genetic basis between schizophrenia and cognitive performance (CP) remains poorly understood. Therefore, we aimed to explore the polygenic overlap between SCZ and CP. Specifically, the bivariate causal mixture model (MiXeR) was employed to estimate the extent of genetic overlap between SCZ (n = 130,644) and CP (n = 257,841), and conjunctional false discovery rate (conjFDR) approach was used to identify shared genetic loci. Subsequently, functional annotation and enrichment analysis were carried out on the identified genomic loci. The MiXeR analyses revealed that 9.6 K genetic variants are associated with SCZ and 10.9 K genetic variants for CP, of which 9.5 K variants are shared between these two traits (Dice coefficient = 92.8%). By employing conjFDR, 236 loci were identified jointly associated with SCZ and CP, of which 139 were novel for the two traits. Within these shared loci, 60 exhibited consistent effect directions, while 176 had opposite effect directions. Functional annotation analysis indicated that the shared genetic loci were mainly located in intronic and intergenic regions, and were found to be involved in relevant biological processes such as nervous system development, multicellular organism development, and generation of neurons. Together, our findings provide insights into the shared genetic architecture between SCZ and CP, suggesting common pathways and mechanisms contributing to both traits.

Ionic liquid post-modified carboxylate-rich MOFs for efficient catalytic CO2 cycloaddition under solvent-free conditions.

The synthesis of cyclic carbonates through cycloaddition reactions between epoxides and carbon dioxide (CO2) is an important industrial process. Metal-Organic Frameworks (MOFs) have functional and ordered pore structures, making them attractive catalysts for converting gas molecules into valuable products. One approach to enhance the catalytic activity of MOFs in CO2 cycloaddition reactions is to create open metal sites within MOFs. In this study, the amino-functionalized rare earth Gd-MOF (Gd-TPTC-NH2) and its ionic liquid composite catalysts (Gd-TPTC-NH-[BMIM]Br) were synthesized using 2'-amino-[1,1':4',1''-terphenyl]-3,3'',5,5''-tetracarboxylic acid (H4TPTC-NH2) as the ligand. The catalytic performance of these two catalysts was observed in the cycloaddition reaction of CO2 and epoxides. Under the optimized reaction conditions, Gd-TPTC-NH-[BMIM]Br can effectively catalyze the cycloaddition reaction of a variety of epoxide substrates with good to excellent yields of cyclic carbonate products. Comparatively, epichlorohydrin and epibromohydrin, which possess halogen substituents, promote higher yields of cyclic carbonates due to the electron-withdrawing nature of Cl and Br substituents. Additionally, the Gd-TPTC-NH-[BMIM]Br catalyst demonstrated good recyclability and reproducibility, maintaining its catalytic activity without any changes in its structure or properties after five reuse cycles.

Optical Information Transmission and Multimode Fluorescence Anticounterfeiting of Ca2-xMgxGe7O16:Mn2.

Multimode emission of Mn2+ for multimode fluorescence anticounterfeiting is achieved by cation site and interstitial occupancy in Ca2-xMgxGe7O16. The rings in Ca2-xMgxGe7O16 have a significant distortion for Mn2+ ions to enter the ring interstitials with a luminescence center at 665 nm, which is supported by XRD refinement results and first-principles calculations. The interstitial Mn2+ ion has good thermal stability with an activation energy of 0.36 eV. Surprisingly, these two luminescence centers, the cation site Mn and the interstitial Mn, have an obvious afterglow, and the disappearing afterglow will reappear by heating or irradiating with the 980 nm laser. The afterglow is significantly enhanced, as MnO2 is used as the manganese source, which is explained in detail by the thermal luminescence spectrum. Finally, Ca2-xMgxGe7O16:Mn2+ fully demonstrates its excellent prospects in fluorescent anticounterfeiting, information encryption, and optical information storage.

The mediating effect of perceived stress on the relationship between big five personality traits and suboptimal health status in Chinese population: a nationwide survey in the framework of predictive, preventive, and personalized medicine.

Background: The effects of psychological factors on suboptimal health status (SHS) have been widely described; however, mechanisms behind the complex relationships among the Big Five personality traits and SHS are unclear. Identifying people with specific traits who are susceptible to SHS will help improve life quality and reduce the chronic disease burden under the framework of predictive, preventive, and personalized medicine (PPPM / 3PM). This study investigated the relationships among personality traits and SHS. It also explored whether perceived stress plays a mediating role in SHS development. Method: A nationwide cross-sectional survey based on multistage random sampling was conducted in 148 cities in China between June 20 and August 31, 2022. Personality traits, perceived stress, and SHS were evaluated using the Big Five Inventory-10 (BFI-10), the 4-item Perceived Stress Scale (PSS-4), and the Short-Form Suboptimal Health Status Questionnaire (SHSQ-SF), respectively. Pearson's correlation analysis was employed to examine the associations between personality traits, perceived stress, and SHS. Structural equation modeling (SEM) was used to discern the mediating role of perceived stress in the relationships among personality traits and SHS. Result: A total of 22,897 participants were enrolled in this study, among whom the prevalence of SHS was 52.9%. SHS was negatively correlated with three trait dimensions (i.e., extraversion, agreeableness, and conscientiousness) but positively correlated with neuroticism. Meanwhile, stress was negatively correlated with extraversion, agreeableness, conscientiousness, and openness, whereas it was positively correlated with neuroticism. The SEM results showed that, when adjusting for covariates (i.e., gender, age, BMI, educational level, current residence, marital status, and occupational status), higher agreeableness (ß = - 0.049, P < 0.001) and conscientiousness (ß = - 0.103, P < 0.001) led to lower SHS prevalence, higher neuroticism (ß = 0.130, P < 0.001), and openness (ß = 0.026, P < 0.001) caused SHS to be more prevalent. Perceived stress played a partial mediating role in the relationships among personality traits and SHS, respectively, contributing 41.3%, 35.9%, and 32.5% to the total effects of agreeableness, conscientiousness, and neuroticism on SHS. Additionally, the mediating impact of stress was significant even though extraversion had no direct effect on SHS. Conclusion: This study revealed a high prevalence of SHS in Chinese residents. Personality traits significantly influenced SHS rates, which perceived stress tended to mediate. From a PPPM perspective, early screening and targeted intervention for people with neuroticism (as well as stress alleviation) might contribute to health enhancement and chronic disease prevention. Supplementary Information: The online version contains supplementary material available at 10.1007/s13167-023-00349-x.

Mapping the landscape: a bibliometric analysis of resting-state fMRI research on schizophrenia over the past 25 years.

Schizophrenia, a multifaceted mental disorder characterized by disturbances in thought, perception, and emotion, has been extensively investigated through resting-state fMRI, uncovering changes in spontaneous brain activity among those affected. However, a bibliometric examination regarding publication trends in resting-state fMRI studies related to schizophrenia is lacking. This study obtained relevant publications from the Web of Science Core Collection spanning the period from 1998 to 2022. Data extracted from these publications included information on countries/regions, institutions, authors, journals, and keywords. The collected data underwent analysis and visualization using VOSviewer software. The primary analyses included examination of international and institutional collaborations, authorship patterns, co-citation analyses of authors and journals, as well as exploration of keyword co-occurrence and temporal trend networks. A total of 859 publications were retrieved, indicating an overall growth trend from 1998 to 2022. China and the United States emerged as the leading contributors in both publication outputs and citations, with Central South University and the University of New Mexico being identified as the most productive institutions. Vince D. Calhoun had the highest number of publications and citation counts, while Karl J. Friston was recognized as the most influential author based on co-citations. Key journals such as Neuroimage, Schizophrenia Research, Schizophrenia Bulletin, and Biological Psychiatry played pivotal roles in advancing this field. Recent popular keywords included support vector machine, antipsychotic medication, transcranial magnetic stimulation, and related terms. This study systematically synthesizes the historical development, current status, and future trends in resting-state fMRI research in schizophrenia, offering valuable insights for future research directions.

Exploring functional dysconnectivity in schizophrenia: alterations in eigenvector centrality mapping and insights into related genes from transcriptional profiles.

Schizophrenia is a mental health disorder characterized by functional dysconnectivity. Eigenvector centrality mapping (ECM) has been employed to investigate alterations in functional connectivity in schizophrenia, yet the results lack consistency, and the genetic mechanisms underlying these changes remain unclear. In this study, whole-brain voxel-wise ECM analyses were conducted on resting-state functional magnetic resonance imaging data. A cohort of 91 patients with schizophrenia and 91 matched healthy controls were included during the discovery stage. Additionally, in the replication stage, 153 individuals with schizophrenia and 182 healthy individuals participated. Subsequently, a comprehensive analysis was performed using an independent transcriptional database derived from six postmortem healthy adult brains to explore potential genetic factors influencing the observed functional dysconnectivity, and to investigate the roles of identified genes in neural processes and pathways. The results revealed significant and reliable alterations in the ECM across multiple brain regions in schizophrenia. Specifically, there was a significant decrease in ECM in the bilateral superior and middle temporal gyrus, and an increase in the bilateral thalamus in both the discovery and replication stages. Furthermore, transcriptional analysis revealed 420 genes whose expression patterns were related to changes in ECM, and these genes were enriched mainly in biological processes associated with synaptic signaling and transmission. Together, this study enhances our knowledge of the neural processes and pathways involved in schizophrenia, shedding light on the genetic factors that may be linked to functional dysconnectivity in this disorder.

Identification and verification of inflammatory biomarkers for primary Sjögren's syndrome.

INTRODUCTION: Primary Sjögren's syndrome (pSS) is an autoimmune disease characterized by inflammatory infiltration, and dysfunction of the salivary and lacrimal glands. This research aimed to explore the disease pathogenesis and improve the diagnosis and treatment of pSS by mining inflammation-associated biomarkers. METHODS: Five pSS-related datasets were retrieved from the Gene Expression Omnibus (GEO) database. Inflammation-associated biomarkers were determined by the least absolute shrinkage and selection operator (LASSO) and support vector machines recursive feature elimination (SVM-RFE). Single sample gene set enrichment analysis (ssGSEA) was implemented to profile the infiltration levels of immune cells. Real-time quantitative PCR (RT-qPCR) verified the expression of biomarkers in clinical samples. RESULTS: Four genes (LY6E, EIF2AK2, IL15, and CXCL10) were screened as inflammation-associated biomarkers in pSS, the predictive performance of which were determined among three pSS-related datasets (AUC > 0.7). Functional enrichment results suggested that the biomarkers were involved in immune and inflammation-related pathways. Immune infiltration analysis revealed that biomarkers were notably connected with type 2 T helper cells, regulatory T cells which were significantly expressed between pSS and control. TESTOSTERONE and CYCLOSPORINE were predicted to take effect by targeting CXCL10 and IL15 in pSS, respectively. CONCLUSION: Four inflammation-associated biomarkers (LY6E, EIF2AK2, IL15, and CXCL10) were explored, and the underlying regulatory mechanisms and targeted drugs associated with these biomarkers were preliminarily investigated according to a series of bioinformatics methods based on the online datasets of pSS, which provided a reference for understanding the pathogenesis of pSS. Key Points • Inflammation-associated biomarkers (LY6E, EIF2AK2, IL15, and CXCL10) were firstly identified in Sjögren's syndrome based on LASSO and SVM-RFE analyses. • CXCL10, EIF2AK2 and LY6E were prominently positively correlated with immature B cells, while IL15 were significantly negatively correlated with memory B cells in Sjögren's syndrome. • LY6E, EIF2AK2, IL15, and CXCL10 were significantly more highly expressed in clinical Sjögren's syndrome samples compared to healthy control samples, which was consistent with the analysis results of the GEO database. •LY6E, EIF2AK2, IL15, and CXCL10 might be used as the biomarkers for the treatment and diagnosis of Sjögren's syndrome.

Molecular basis of chromatin remodelling by DDM1 involved in plant DNA methylation.

Eukaryotic gene regulation occurs at the chromatin level, which requires changing the chromatin structure by a group of ATP-dependent DNA translocases-namely, the chromatin remodellers1. In plants, chromatin remodellers function in various biological processes and possess both conserved and plant-specific components2-5. DECREASE IN DNA METHYLATION 1 (DDM1) is a plant chromatin remodeller that plays a key role in the maintenance DNA methylation6-11. Here we determined the structures of Arabidopsis DDM1 in complex with nucleosome in ADP-BeFx-bound, ADP-bound and nucleotide-free conformations. We show that DDM1 specifically recognizes the H4 tail and nucleosomal DNA. The conformational differences between ADP-BeFx-bound, ADP-bound and nucleotide-free DDM1 suggest a chromatin remodelling cycle coupled to ATP binding, hydrolysis and ADP release. This, in turn, triggers conformational changes in the DDM1-bound nucleosomal DNA, which alters the nucleosome structure and promotes DNA sliding. Together, our data reveal the molecular basis of chromatin remodelling by DDM1.

CRB1-associated retinal degeneration is dependent on bacterial translocation from the gut.

The Crumbs homolog 1 (CRB1) gene is associated with retinal degeneration, most commonly Leber congenital amaurosis (LCA) and retinitis pigmentosa (RP). Here, we demonstrate that murine retinas bearing the Rd8 mutation of Crb1 are characterized by the presence of intralesional bacteria. While normal CRB1 expression was enriched in the apical junctional complexes of retinal pigment epithelium and colonic enterocytes, Crb1 mutations dampened its expression at both sites. Consequent impairment of the outer blood retinal barrier and colonic intestinal epithelial barrier in Rd8 mice led to the translocation of intestinal bacteria from the lower gastrointestinal (GI) tract to the retina, resulting in secondary retinal degeneration. Either the depletion of bacteria systemically or the reintroduction of normal Crb1 expression colonically rescued Rd8-mutation-associated retinal degeneration without reversing the retinal barrier breach. Our data elucidate the pathogenesis of Crb1-mutation-associated retinal degenerations and suggest that antimicrobial agents have the potential to treat this devastating blinding disease.

An Improved Nested U-Net Network for Fluorescence In Situ Hybridization Cell Image Segmentation.

Fluorescence in situ hybridization (FISH) is a powerful cytogenetic method used to precisely detect and localize nucleic acid sequences. This technique is proving to be an invaluable tool in medical diagnostics and has made significant contributions to biology and the life sciences. However, the number of cells is large and the nucleic acid sequences are disorganized in the FISH images taken using the microscope. Processing and analyzing images is a time-consuming and laborious task for researchers, as it can easily tire the human eyes and lead to errors in judgment. In recent years, deep learning has made significant progress in the field of medical imaging, especially the successful application of introducing the attention mechanism. The attention mechanism, as a key component of deep learning, improves the understanding and interpretation of medical images by giving different weights to different regions of the image, enabling the model to focus more on important features. To address the challenges in FISH image analysis, we combined medical imaging with deep learning to develop the SEAM-Unet++ automated cell contour segmentation algorithm with integrated attention mechanism. The significant advantage of this algorithm is that it improves the accuracy of cell contours in FISH images. Experiments have demonstrated that by introducing the attention mechanism, our method is able to segment cells that are adherent to each other more efficiently.

Nitrogen-doped carbon material NCM-T heterogeneously catalyzed liquid-phase hydrogenation of nitrobenzene to aniline.

As an important chemical intermediate, aniline is primarily produced industrially through catalytic hydrogenation of nitrobenzene. Herein, a series of nitrogen-doped carbon materials (referred to as NCM-T, with T denoting the roasting temperature (°C)) were prepared through high-temperature roasting of sucrose and melamine for the heterogeneous catalytic liquid-phase hydrogenation of nitrobenzene to aniline. A preliminary study of the involved reaction mechanism was performed by combining the results of material characterisation and catalyst evaluation. Experimental results showed that the graphitic N content and the defective sites simultaneously affected the performance of NCM-T in catalysing the hydrazine hydrate reduction in the nitrobenzene hydrogenation reaction. The catalyst NCM-800 was reacted in an ethanol solution with hydrazine hydrate as the reducing agent at 80 °C for 5 h. Notably, the nitrobenzene conversion rate was up to 94%, and the aniline selectivity was 100%. The turnover frequency (TOF) could reach up to 7.9 mol g-1 h-1, and after five recycling cycles, only a small loss of catalytic activity was observed. This shows that the prepared catalyst is a recyclable catalyst that can be used for reducing the nitrobenzene from hydrazine hydrate to aniline.